miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-1908-5p | ||||
| miRNA Stemloop AC | MI0008329 | ||||
| miRNA Stemloop ID | hsa-mir-1908 | ||||
| Sequence | cggcggggacggcgauugguc | ||||
| TTD Target(s) Regulated by This miRNA | Apolipoprotein E (APOE) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | DnaJ homolog subfamily A member 4 | Regulated Protein | [1] | ||
| NF-kappa-B inhibitor-interacting Ras-like protein 2 | Regulated Protein | [3] | |||
| Ski oncogene | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Convergent multi-miRNA targeting of ApoE drives LRP1/LRP8-dependent melanoma metastasis and angiogenesis. Cell. 2012 Nov 21;151(5):1068-82. | ||||
| REF 2 | Convergent multi-miRNA targeting of ApoE drives LRP1/LRP8-dependent melanoma metastasis and angiogenesis. Cell. 2012 Nov 21;151(5):1068-82. | ||||
| REF 3 | MicroRNA-1908-5p contributes to the oncogenic function of the splicing factor SRSF3.Oncotarget. 2017 Jan 31;8(5):8342-8355. | ||||
| REF 4 | MiR-1908 promotes scar formation post-burn wound healing by suppressing Ski-mediated inflammation and fibroblast proliferation.Cell Tissue Res. 2016 Nov;366(2):371-380. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.