miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-193b-5p | ||||
| miRNA Stemloop AC | MI0003137 | ||||
| miRNA Stemloop ID | hsa-mir-193b | ||||
| Sequence | cgggguuuugagggcgagauga | ||||
| TTD Target(s) Regulated by This miRNA | Stathmin-1 (STMN1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Cysteine-rich motor neuron 1 protein | Regulated Protein | [2] | ||
| Interferon-induced protein with tetratricopeptide repeats 2 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | miR-193b directly targets STMN1 and inhibits the malignant phenotype in colorectal cancer. Am J Cancer Res. 2016 Nov 1;6(11):2463-2475. | ||||
| REF 2 | Genetic variation that predicts platinum sensitivity reveals the role of miR-193b* in chemotherapeutic susceptibility.Mol Cancer Ther. 2012 Sep;11(9):2054-61. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.