miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-199b-3p | ||||
| miRNA Stemloop AC | MI0000282 | ||||
| miRNA Stemloop ID | hsa-mir-199b | ||||
| Sequence | acaguagucugcacauugguua | ||||
| TTD Target(s) Regulated by This miRNA | PAK-4 protein kinase (PAK4) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Integrin alpha-3 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MiR-199a/b-3p suppresses migration and invasion of breast cancer cells by downregulating PAK4/MEK/ERK signaling pathway. IUBMB Life. 2015 Oct;67(10):768-77. | ||||
| REF 2 | Regulation of ITGA3 by the dual-stranded microRNA-199 family as a potential prognostic marker in bladder cancer.Br J Cancer. 2017 Apr 11;116(8):1077-1087. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.