miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-200a-5p | ||||
| miRNA Stemloop AC | MI0000737 | ||||
| miRNA Stemloop ID | hsa-mir-200a | ||||
| Sequence | caucuuaccggacagugcugga | ||||
| TTD Target(s) Regulated by This miRNA | Beta-catenin (CTNNB1) | Successful Target | Target Info | [1] | |
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Transcription factor SOX-17 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | The lncRNA H19 Promotes Cell Proliferation by Competitively Binding to miR-200a and Derepressing -Catenin Expression in Colorectal Cancer. Biomed Res Int. 2017;2017:2767484. | ||||
| REF 2 | MiR-200a acts as an oncogene in colorectal carcinoma by targeting PTEN. Exp Mol Pathol. 2016 Dec;101(3):308-313. | ||||
| REF 3 | Changes in microRNA expression during differentiation of embryonic and induced pluripotent stem cells to definitive endoderm.Gene Expr Patterns. 2015 Sep-Nov;19(1-2):70-82. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.