miRNA General Information
miRNA Mature ID	hsa-miR-200c-5p
miRNA Stemloop AC	MI0000650
miRNA Stemloop ID	hsa-mir-200c
Sequence	cgucuuacccagcaguguuugg
TTD Target(s) Regulated by This miRNA	Cytochrome P450 1B1 (CYP1B1)	Clinical trial Target	Target Info	[1]
	Hypoxia-inducible factor 1 alpha (HIF-1A)	Clinical trial Target	Target Info	[2]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[3]
	Polycomb complex protein BMI-1 (BMI1)	Clinical trial Target	Target Info	[4]
	Epithelial cadherin (CDH1)	Literature-reported Target	Target Info	[3]
References
REF 1	Loss of miR-200c up-regulates CYP1B1 and confers docetaxel resistance in renal cell carcinoma. Oncotarget. 2015 Apr 10;6(10):7774-87.
REF 2	Identification of Dormancy-Associated MicroRNAs for the Design of Osteosarcoma-Targeted Dendritic Polyglycerol Nanopolyplexes. ACS Nano. 2016 Feb 23;10(2):2028-45.
REF 3	The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151.
REF 4	miR-200c inhibits invasion, migration and proliferation of bladder cancer cells through down-regulation of BMI-1 and E2F3. J Transl Med. 2014 Nov 4;12:305.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.