miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-205-3p | ||||
| miRNA Stemloop AC | MI0000285 | ||||
| miRNA Stemloop ID | hsa-mir-205 | ||||
| Sequence | gauuucaguggagugaaguuc | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [1] | |
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | COMM domain-containing protein 1 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miRNA-205 targets VEGFA and FGF2 and regulates resistance to chemotherapeutics in breast cancer. Cell Death Dis. 2016 Jun 30;7(6):e2291. | ||||
| REF 2 | Downregulation of COMMD1 by miR-205 promotes a positive feedback loop for amplifying inflammatory- and stemness-associated properties of cancer cells.Cell Death Differ. 2016 May;23(5):841-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.