miRNA General Information
miRNA Mature ID	hsa-miR-21-3p
miRNA Stemloop AC	MI0000077
miRNA Stemloop ID	hsa-mir-21
Sequence	caacaccagucgaugggcugu
TTD Target(s) Regulated by This miRNA	Signal transducer and activator of transcription 3 (STAT3)	Successful Target	Target Info	[1]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[2]
	Apoptosis antigen ligand (CD178)	Literature-reported Target	Target Info	[3]
Protein(s) Regulated by This miRNA	15-hydroxyprostaglandin dehydrogenase [NAD(+)]	Regulated Protein	PGDH_HUMAN	[4]
	Methionine adenosyltransferase 2 subunit beta	Regulated Protein	MAT2B_HUMAN	[5]
	Neural cell adhesion molecule L1	Regulated Protein	L1CAM_HUMAN	[6]
	Programmed cell death protein 4	Regulated Protein	PDCD4_HUMAN	[7]
	Programmed cell death protein 4	Regulated Protein	PDCD4_HUMAN	[8]
	RCC1 and BTB domain-containing protein 1	Regulated Protein	RCBT1_HUMAN	[9]
	RNA-binding protein with multiple splicing	Regulated Protein	RBPMS_HUMAN	[9]
	S-adenosylmethionine synthase isoform type-2	Regulated Protein	METK2_HUMAN	[5]
	Zinc finger protein 350	Regulated Protein	ZN350_HUMAN	[10]
	Zinc finger protein 608	Regulated Protein	ZN608_HUMAN	[9]
References
REF 1	Effects of microRNA-21 on the biological functions of T-cell acute lymphoblastic lymphoma/leukemia. Oncol Lett. 2016 Nov;12(5):4173-4180.
REF 2	Overexpression of miR-21 promotes the proliferation and migration of cervical cancer cells via the inhibition of PTEN. Oncol Rep. 2015 Jun;33(6):3108-16.
REF 3	MiR-21 up-regulation mediates glioblastoma cancer stem cells apoptosis and proliferation by targeting FASLG. Mol Biol Rep. 2015 Mar;42(3):721-7.
REF 4	MicroRNA-21 regulates prostaglandin E2 signaling pathway by targeting 15-hydroxyprostaglandin dehydrogenase in tongue squamous cell carcinoma.BMC Cancer. 2016 Aug 25;16(1):685.
REF 5	MicroRNA-21-3p, a berberine-induced miRNA, directly down-regulates human methionine adenosyltransferases 2A and 2B and inhibits hepatoma cell growth.PLoS One. 2013 Sep 30;8(9):e75628.
REF 6	Human microRNA expression in sporadic and FAP-associated desmoid tumors and correlation with beta-catenin mutations.Oncotarget. 2017 Jun 27;8(26):41866-41875.
REF 7	ERK8 is a novel HuR kinase that regulates tumour suppressor PDCD4 through a miR-21 dependent mechanism.Oncotarget. 2016 Jan 12;7(2):1439-50.
REF 8	Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells.J Cancer. 2017 Jan 1;8(1):57-64.
REF 9	Targeting miR-21-3p inhibits proliferation and invasion of ovarian cancer cells.Oncotarget. 2016 Jun 14;7(24):36321-36337.
REF 10	Functional SNP in 3'-UTR MicroRNA-Binding Site of ZNF350 Confers Risk for Age-Related Cataract.Hum Mutat. 2016 Nov;37(11):1223-1230.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.