miRNA General Information
miRNA Mature ID	hsa-miR-215-3p
miRNA Stemloop AC	MI0000291
miRNA Stemloop ID	hsa-mir-215
Sequence	ucugucauuucuuuaggccaaua
TTD Target(s) Regulated by This miRNA	Forkhead box protein O1A (FOXO1)	Literature-reported Target	Target Info	[1]
References
REF 1	miR-215 promotes cell migration and invasion of gastric cancer cell lines by targeting FOXO1. Neoplasma. 2017;64(4):579-587.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.