miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-216a-5p | ||||
| miRNA Stemloop AC | MI0000292 | ||||
| miRNA Stemloop ID | hsa-mir-216a | ||||
| Sequence | uaaucucagcuggcaacuguga | ||||
| TTD Target(s) Regulated by This miRNA | Janus kinase 2 (JAK-2) | Successful Target | Target Info | [1] | |
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [2] | ||
| Extracellular matrix receptor III (CD44) | Clinical trial Target | Target Info | [3] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [4] | ||
| Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [5] | ||
| Signal transduction protein CBL (CBL) | Literature-reported Target | Target Info | [6] | ||
| Beclin-1 (BECN1) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Cell division control protein 42 homolog | Regulated Protein | [3] | ||
| Cell migration-inducing and hyaluronan-binding protein | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | miR-216a may inhibit pancreatic tumor growth by targeting JAK2. FEBS Lett. 2015 Aug 4;589(17):2224-32. | ||||
| REF 2 | MicroRNA 217 modulates endothelial cell senescence via silent information regulator 1. Circulation. 2009 Oct 13;120(15):1524-32. | ||||
| REF 3 | Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41. | ||||
| REF 4 | TGF-beta activates Akt kinase through a microRNA-dependent amplifying circuit targeting PTEN. Nat Cell Biol. 2009 Jul;11(7):881-9. | ||||
| REF 5 | The role of microRNAs in hepatocyte nuclear factor-4alpha expression and transactivation. Biochim Biophys Acta. 2013 May;1829(5):436-42. | ||||
| REF 6 | miR-216a rescues dexamethasone suppression of osteogenesis, promotes osteoblast differentiation and enhances bone formation, by regulating c-Cbl-mediated PI3K/AKT pathway. Cell Death Differ. 2015 Dec;22(12):1935-45. | ||||
| REF 7 | MiR-216a: a link between endothelial dysfunction and autophagy. Cell Death Dis. 2014 Jan 30;5:e1029. | ||||
| REF 8 | Expression of CD44 3'-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis. Nucleic Acids Res. 2011 Apr;39(8):3026-41. | ||||
| REF 9 | Down-regulation of KIAA1199/CEMIP by miR-216a suppresses tumor invasion and metastasis in colorectal cancer.Int J Cancer. 2017 May 15;140(10):2298-2309. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.