miRNA General Information
miRNA Mature ID	hsa-miR-222-5p
miRNA Stemloop AC	MI0000299
miRNA Stemloop ID	hsa-mir-222
Sequence	cucaguagccaguguagauccu
TTD Target(s) Regulated by This miRNA	CDK inhibitor 1C p57Kip2 (CDKN1C)	Literature-reported Target	Target Info	[1]
References
REF 1	Epstein-Barr Virus Proteins EBNA3A and EBNA3C Together Induce Expression of the Oncogenic MicroRNA Cluster miR-221/miR-222 and Ablate Expression of Its Target p57KIP2. PLoS Pathog. 2015 Jul 8;11(7):e1005031.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.