miRNA General Information
miRNA Mature ID	hsa-miR-23c
miRNA Stemloop AC	MI0016010
miRNA Stemloop ID	hsa-mir-23c
Sequence	aucacauugccagugauuaccc
TTD Target(s) Regulated by This miRNA	ELAV-like protein 1 (ELAVL1)	Literature-reported Target	Target Info	[1]
References
REF 1	Long noncoding RNA MALAT1 regulates renal tubular epithelial pyroptosis by modulated miR-23c targeting of ELAVL1 in diabetic nephropathy. Exp Cell Res. 2017 Jan 15;350(2):327-335.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.