miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-24-1-5p | ||||
| miRNA Stemloop AC | MI0000080 | ||||
| miRNA Stemloop ID | hsa-mir-24-1 | ||||
| Sequence | ugccuacugagcugauaucagu | ||||
| TTD Target(s) Regulated by This miRNA | Hepatocyte nuclear factor 4-alpha (HNF4A) | Literature-reported Target | Target Info | [1] | |
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Angiopoietin-related protein 2 | Regulated Protein | [3] | ||
| Hypoxia-inducible factor 1-alpha inhibitor | Regulated Protein | [4] | |||
| Serine/threonine-protein kinase WNK1 | Regulated Protein | [5] | |||
| SLIT and NTRK-like protein 1 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | MiRNA-Based Regulation of Hemostatic Factors through Hepatic Nuclear Factor-4 Alpha. PLoS One. 2016 May 2;11(5):e0154751. | ||||
| REF 2 | Tumour-suppressive microRNA-24-1 inhibits cancer cell proliferation through targeting FOXM1 in bladder cancer. FEBS Lett. 2014 Aug 25;588(17):3170-9. | ||||
| REF 3 | Suppressive action of miRNAs to ARP2/3 complex reduces cell migration and proliferation via RAC isoforms in Hirschsprung disease.J Cell Mol Med. 2016 Jul;20(7):1266-75. | ||||
| REF 4 | MiR-24 induces chemotherapy resistance and hypoxic advantage in breast cancer.Oncotarget. 2017 Mar 21;8(12):19507-19521. | ||||
| REF 5 | The NF-B p65/miR-23a-27a-24 cluster is a target for leukemia treatment.Oncotarget. 2015 Oct 20;6(32):33554-67. | ||||
| REF 6 | Sequence variants in SLITRK1 are associated with Tourette's syndrome. Science. 2005 Oct 14;310(5746):317-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.