miRNA General Information
miRNA Mature ID	hsa-miR-24-3p
miRNA Stemloop AC	MI0000080 | MI0000081
miRNA Stemloop ID	hsa-mir-24-1 | hsa-mir-24-2
Sequence	uggcucaguucagcaggaacag
TTD Target(s) Regulated by This miRNA	Cyclin-dependent kinase 4 (CDK4)	Successful Target	Target Info	[1]
	Dihydrofolate reductase (DHFR)	Successful Target	Target Info	[2]
	Aurora kinase B (AURKB)	Clinical trial Target	Target Info	[3]
	Stress-activated protein kinase 2a (p38 alpha)	Clinical trial Target	Target Info	[4]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[5]
	Cyclin A2 (CCNA2)	Literature-reported Target	Target Info	[6]
	Activin receptor type IB (ACVR1B)	Patented-recorded Target	Target Info	[7]
	Multiple tumor suppressor 1 (CDKN2A)	Literature-reported Target	Target Info	[8]
	Transcription factor E2F2 (E2F2)	Literature-reported Target	Target Info	[9]
Protein(s) Regulated by This miRNA	ATP-binding cassette sub-family B member 9	Regulated Protein	ABCB9_HUMAN	[10]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[11]
	Bcl-2-like protein 12	Regulated Protein	B2L12_HUMAN	[3]
	Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 1	Regulated Protein	NDST1_HUMAN	[13]
	Breast cancer anti-estrogen resistance protein 1	Regulated Protein	BCAR1_HUMAN	[14]
	Breast cancer type 1 susceptibility protein	Regulated Protein	BRCA1_HUMAN	[3]
	C-C motif chemokine 4	Regulated Protein	CCL4_HUMAN	[15]
	Caspase recruitment domain-containing protein 10	Regulated Protein	CAR10_HUMAN	[16]
	Coronin-1A	Regulated Protein	COR1A_HUMAN	[17]
	Cysteine protease ATG4A	Regulated Protein	ATG4A_HUMAN	[18]
	Cytosolic non-specific dipeptidase	Regulated Protein	CNDP2_HUMAN	[3]
	Dead end protein homolog 1	Regulated Protein	DND1_HUMAN	[19]
	Death effector domain-containing protein	Regulated Protein	DEDD_HUMAN	[17]
	DNA polymerase delta catalytic subunit	Regulated Protein	DPOD1_HUMAN	[3]
	DNA replication licensing factor MCM4	Regulated Protein	MCM4_HUMAN	[3]
	E3 ubiquitin-protein ligase TRIM11	Regulated Protein	TRI11_HUMAN	[20]
	Eukaryotic translation initiation factor 2 subunit 3	Regulated Protein	IF2G_HUMAN	[21]
	Far upstream element-binding protein 2	Regulated Protein	FUBP2_HUMAN	[22]
	FAS-associated factor 1	Regulated Protein	FAF1_HUMAN	[23]
	Fibroblast growth factor 11	Regulated Protein	FGF11_HUMAN	[24]
	Flap endonuclease 1	Regulated Protein	FEN1_HUMAN	[3]
	Insulin-induced gene 1 protein	Regulated Protein	INSI1_HUMAN	[25]
	Interferon alpha/beta receptor 1	Regulated Protein	INAR1_HUMAN	[26]
	Junctophilin-2	Regulated Protein	JPH2_HUMAN	[27]
	L-lactate dehydrogenase B chain	Regulated Protein	LDHB_HUMAN	[28]
	Malectin	Regulated Protein	MLEC_HUMAN	[4]
	Malectin	Regulated Protein	MLEC_HUMAN	[3]
	Max-interacting protein 1	Regulated Protein	MXI1_HUMAN	[30]
	Menin	Regulated Protein	MEN1_HUMAN	[31]
	Metallothionein-1M	Regulated Protein	MT1M_HUMAN	[32]
	Methyl-CpG-binding domain protein 6	Regulated Protein	MBD6_HUMAN	[3]
	Neurocan core protein	Regulated Protein	NCAN_HUMAN	[33]
	Nicastrin	Regulated Protein	NICA_HUMAN	[34]
	Nuclear factor of activated T-cells 5	Regulated Protein	NFAT5_HUMAN	[22]
	Period circadian protein homolog 2	Regulated Protein	PER2_HUMAN	[3]
	Peroxiredoxin-6	Regulated Protein	PRDX6_HUMAN	[35]
	Prosaposin	Regulated Protein	SAP_HUMAN	[36]
	Protein MCM10 homolog	Regulated Protein	MCM10_HUMAN	[3]
	Protein Wnt-4	Regulated Protein	WNT4_HUMAN	[37]
	Receptor-type tyrosine-protein phosphatase F	Regulated Protein	PTPRF_HUMAN	[38]
	Rho GTPase-activating protein 19	Regulated Protein	RHG19_HUMAN	[39]
	SH3 and PX domain-containing protein 2A	Regulated Protein	SPD2A_HUMAN	[39]
	Sjoegren syndrome/scleroderma autoantigen 1	Regulated Protein	SSA27_HUMAN	[40]
	Suppressor of tumorigenicity 7 protein-like	Regulated Protein	ST7L_HUMAN	[41]
	Syntaxin-16	Regulated Protein	STX16_HUMAN	[42]
	Transcription factor MafB	Regulated Protein	MAFB_HUMAN	[43]
	Transmembrane emp24 domain-containing protein 7	Regulated Protein	TMED7_HUMAN	[3]
	Transmembrane protein 92	Regulated Protein	TMM92_HUMAN	[44]
	Tribbles homolog 3	Regulated Protein	TRIB3_HUMAN	[45]
	Tyrosine-protein phosphatase non-receptor type 9	Regulated Protein	PTN9_HUMAN	[38]
	Ubiquitin D	Regulated Protein	UBD_HUMAN	[3]
	Zinc finger protein 317	Regulated Protein	ZN317_HUMAN	[2]
References
REF 1	microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 2	A miR-24 microRNA binding-site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance. Proc Natl Acad Sci U S A. 2007 Aug 14;104(33):13513-8.
REF 3	miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
REF 4	A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 5	Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 6	MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 7	MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4. Blood. 2008 Jan 15;111(2):588-95.
REF 8	p16(INK4a) translation suppressed by miR-24. PLoS One. 2008 Mar 26;3(3):e1864.
REF 9	Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61.
REF 10	Overexpression of microRNA-24 increases the sensitivity to paclitaxel in drug-resistant breast carcinoma cell lines via targeting ABCB9. Oncol Lett. 2016 Nov;12(5):3905-3911.
REF 11	Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50.
REF 12	miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
REF 13	MicroRNA-24 suppression of N-deacetylase/N-sulfotransferase-1 (NDST1) reduces endothelial cell responsiveness to vascular endothelial growth factor A (VEGFA).J Biol Chem. 2013 Sep 6;288(36):25956-63.
REF 14	The miR-24-3p/p130Cas: a novel axis regulating the migration and invasion of cancer cells.Sci Rep. 2017 Mar 24;7:44847.
REF 15	Bioinformatic analysis of microRNA and mRNA Regulation in peripheral blood mononuclear cells of patients with chronic obstructive pulmonary disease.Respir Res. 2017 Jan 5;18(1):4.
REF 16	MicroRNA-24 upregulation inhibits proliferation, metastasis and induces apoptosis in bladder cancer cells by targeting CARMA3.Int J Oncol. 2015 Oct;47(4):1351-60.
REF 17	miR-24 up-regulation in oral carcinoma: positive association from clinical and in vitro analysis.Oral Oncol. 2010 Mar;46(3):204-8.
REF 18	Mir-24-3p downregulation contributes to VP16-DDP resistance in small-cell lung cancer by targeting ATG4A.Oncotarget. 2015 Jan 1;6(1):317-31.
REF 19	MicroRNA-24 targeting RNA-binding protein DND1 in tongue squamous cell carcinoma.FEBS Lett. 2010 Sep 24;584(18):4115-20.
REF 20	TRIM11, a direct target of miR-24-3p, promotes cell proliferation and inhibits apoptosis in colon cancer.Oncotarget. 2016 Dec 27;7(52):86755-86765.
REF 21	Functional microRNAs and target sites are created by lineage-specific transposition.Hum Mol Genet. 2014 Apr 1;23(7):1783-93.
REF 22	Aberration of blastocyst microRNA expression is associated with human infertility.Fertil Steril. 2010 May 1;93(7):2374-82.
REF 23	miR-24 regulates apoptosis by targeting the open reading frame (ORF) region of FAF1 in cancer cells.PLoS One. 2010 Feb 25;5(2):e9429.
REF 24	Exosomal miR-24-3p impedes T-cell function by targeting FGF11 and serves as a potential prognostic biomarker for nasopharyngeal carcinoma.J Pathol. 2016 Nov;240(3):329-340.
REF 25	Inhibition of microRNA-24 expression in liver prevents hepatic lipid accumulation and hyperlipidemia.Hepatology. 2014 Aug;60(2):554-64.
REF 26	The TGF--inducible miR-23a cluster attenuates IFN- levels and antigen-specific cytotoxicity in human CD8 T cells. J Leukoc Biol. 2014 Oct;96(4):633-45.
REF 27	Mir-24 regulates junctophilin-2 expression in cardiomyocytes.Circ Res. 2012 Sep 14;111(7):837-41.
REF 28	Estrogen and retinoic acid antagonistically regulate several microRNA genes to control aerobic glycolysis in breast cancer cells. Mol Biosyst. 2012 Oct 30;8(12):3242-53.
REF 29	A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 30	miR-24-3p and miR-27a-3p promote cell proliferation in glioma cells via cooperative regulation of MXI1.Int J Oncol. 2013 Feb;42(2):757-66.
REF 31	The negative feedback-loop between the oncomir Mir-24-1 and menin modulates the Men1 tumorigenesis by mimicking the "Knudson's second hit".PLoS One. 2012;7(6):e39767.
REF 32	MiR-24-3p enhances cell growth in hepatocellular carcinoma by targeting metallothionein 1M.Cell Biochem Funct. 2016 Oct;34(7):491-496.
REF 33	Antihypoxic effect of miR-24 in SH-SY5Y cells under hypoxia via downregulating expression of neurocan.Biochem Biophys Res Commun. 2016 Sep 2;477(4):692-699.
REF 34	MicroRNAs targeting Nicastrin regulate A production and are affected by target site polymorphisms.Front Mol Neurosci. 2014 Jul 18;7:67.
REF 35	miR-24-3p Regulates Progression of Gastric Mucosal Lesions and Suppresses Proliferation and Invasiveness of N87 Via Peroxiredoxin 6.Dig Dis Sci. 2016 Dec;61(12):3486-3497.
REF 36	The microRNA-23b/27b/24 cluster promotes breast cancer lung metastasis by targeting metastasis-suppressive gene prosaposin.J Biol Chem. 2014 Aug 8;289(32):21888-95.
REF 37	Wnt4 inhibits cell motility induced by oncogenic Ras.Oncogene. 2013 Aug 29;32(35):4110-9.
REF 38	MicroRNA miR-24 enhances tumor invasion and metastasis by targeting PTPN9 and PTPRF to promote EGF signaling.J Cell Sci. 2013 Mar 15;126(Pt 6):1440-53.
REF 39	miR-24 triggers epidermal differentiation by controlling actin adhesion and cell migration.J Cell Biol. 2012 Oct 15;199(2):347-63.
REF 40	miR-24 and miR-205 expression is dependent on HPV onco-protein expression in keratinocytes.Virology. 2014 Jan 5;448:210-6.
REF 41	MiR-24 regulates the proliferation and invasion of glioma by ST7L via -catenin/Tcf-4 signaling.Cancer Lett. 2013 Feb 28;329(2):174-80.
REF 42	Exploration of human miRNA target genes in neuronal differentiation. Nucleic Acids Symp Ser (Oxf). 2005;(49):341-2.
REF 43	Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31.
REF 44	MiR-23a/-24-induced gene silencing results in mesothelial cell integration of pancreatic cancer.Br J Cancer. 2015 Jan 6;112(1):131-9.
REF 45	Molecular basis for antagonism between PDGF and the TGFbeta family of signalling pathways by control of miR-24 expression.EMBO J. 2010 Feb 3;29(3):559-73.
REF 46	A miR-24 microRNA binding-site polymorphism in dihydrofolate reductase gene leads to methotrexate resistance. Proc Natl Acad Sci U S A. 2007 Aug 14;104(33):13513-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.