miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-28-3p | ||||
| miRNA Stemloop AC | MI0000086 | ||||
| miRNA Stemloop ID | hsa-mir-28 | ||||
| Sequence | cacuagauugugagcuccugga | ||||
| TTD Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Signal transducer and activator of transcription 5B | Regulated Protein | [1] | ||
| References | |||||
| REF 1 | Persistent STAT5 activation in myeloid neoplasms recruits p53 into gene regulation. Oncogene. 2015 Mar 5;34(10):1323-32. | ||||
| REF 2 | Persistent STAT5 activation in myeloid neoplasms recruits p53 into gene regulation. Oncogene. 2015 Mar 5;34(10):1323-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.