miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-296-3p | ||||
miRNA Stemloop AC | MI0000747 | ||||
miRNA Stemloop ID | hsa-mir-296 | ||||
Sequence | gaggguuggguggaggcucucc | ||||
TTD Target(s) Regulated by This miRNA | Intercellular adhesion molecule ICAM-1 (ICAM1) | Successful Target | Target Info | [1] | |
Voltage-gated potassium channel Kv10.1 (KCNH1) | Literature-reported Target | Target Info | [2] | ||
C-X3-C chemokine receptor 1 (CX3CR1) | Literature-reported Target | Target Info | [3] | ||
References | |||||
REF 1 | MiRNA-296-3p-ICAM-1 axis promotes metastasis of prostate cancer by possible enhancing survival of natural killer cell-resistant circulating tumour cells. Cell Death Dis. 2013 Nov 21;4:e928. | ||||
REF 2 | MiR-296-3p regulates cell growth and multi-drug resistance of human glioblastoma by targeting ether- go-go (EAG1). Eur J Cancer. 2013 Feb;49(3):710-24. | ||||
REF 3 | miRNA-296-3p modulates chemosensitivity of lung cancer cells by targeting CX3CR1. Am J Transl Res. 2016 Apr 15;8(4):1848-56. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.