miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-299-3p | ||||
| miRNA Stemloop AC | MI0000744 | ||||
| miRNA Stemloop ID | hsa-mir-299 | ||||
| Sequence | uaugugggaugguaaaccgcuu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | ATP-binding cassette sub-family E member 1 | Regulated Protein | [2] | ||
| Frataxin, mitochondrial | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MicroRNA 299-3p modulates replicative senescence in endothelial cells. Physiol Genomics. 2013 Apr 1;45(7):256-67. | ||||
| REF 2 | MicroRNA-299-3p promotes the sensibility of lung cancer to doxorubicin through directly targeting ABCE1. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10072-81. | ||||
| REF 3 | Genetic variations creating microRNA target sites in the FXN 3'-UTR affect frataxin expression in Friedreich ataxia.PLoS One. 2013;8(1):e54791. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.