miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-29b-1-5p | ||||
| miRNA Stemloop AC | MI0000105 | ||||
| miRNA Stemloop ID | hsa-mir-29b-1 | ||||
| Sequence | gcugguuucauauggugguuuaga | ||||
| TTD Target(s) Regulated by This miRNA | Janus kinase 3 (JAK-3) | Successful Target | Target Info | [1] | |
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [2] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [3] | ||
| RAC-gamma serine/threonine-protein kinase (AKT3) | Successful Target | Target Info | [4] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Preclinical Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Collagen alpha-1(I) chain | Regulated Protein | [5] | ||
| Collagen alpha-1(III) chain | Regulated Protein | [5] | |||
| Collagen alpha-1(V) chain | Regulated Protein | [5] | |||
| Transcription factor jun-D | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | miR-29b and miR-198 overexpression in CD8+ T cells of renal cell carcinoma patients down-modulates JAK3 and MCL-1 leading to immune dysfunction. J Transl Med. 2016 Apr 11;14:84. | ||||
| REF 2 | Chemotherapy-mediated miR-29b expression inhibits the invasion and angiogenesis of cervical cancer. Oncotarget. 2017 Feb 28;8(9):14655-14665. | ||||
| REF 3 | Suppressive effect of microRNA-29b on hepatic stellate cell activation and its crosstalk with TGF-1/Smad3. Cell Biochem Funct. 2016 Jul;34(5):326-33. | ||||
| REF 4 | MiRNA-29b suppresses tumor growth through simultaneously inhibiting angiogenesis and tumorigenesis by targeting Akt3. Cancer Lett. 2017 Jul 1;397:111-119. | ||||
| REF 5 | Cyclic stretch and compression forces alter microRNA-29 expression of human periodontal ligament cells.Gene. 2015 Jul 15;566(1):13-7. | ||||
| REF 6 | JunD enhances miR-29b levels transcriptionally and posttranscriptionally to inhibit proliferation of intestinal epithelial cells.Am J Physiol Cell Physiol. 2015 May 15;308(10):C813-24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.