miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-300 | ||||
| miRNA Stemloop AC | MI0005525 | ||||
| miRNA Stemloop ID | hsa-mir-300 | ||||
| Sequence | uauacaagggcagacucucucu | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Ros (ROS1) | Successful Target | Target Info | [1] | |
| Rho-associated protein kinase 1 (ROCK1) | Successful Target | Target Info | [2] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [3] | ||
| Bromodomain-containing protein 7 (BRD7) | Literature-reported Target | Target Info | [4] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Twist-related protein 1 | Regulated Protein | [5] | ||
| References | |||||
| REF 1 | MiR-300 suppresses laryngeal squamous cell carcinoma proliferation and metastasis by targeting ROS1. Am J Transl Res. 2016 Sep 15;8(9):3903-3911. | ||||
| REF 2 | MicroRNA-300 inhibited glioblastoma progression through ROCK1. Oncotarget. 2016 Jun 14;7(24):36529-36538. | ||||
| REF 3 | MiR-300 regulate the malignancy of breast cancer by targeting p53. Int J Clin Exp Med. 2015 May 15;8(5):6957-66. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707. | ||||
| REF 6 | MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.