miRNA General Information
miRNA Mature ID hsa-miR-300
miRNA Stemloop AC MI0005525
miRNA Stemloop ID hsa-mir-300
Sequence uauacaagggcagacucucucu
TTD Target(s) Regulated by This miRNA Proto-oncogene c-Ros (ROS1) Successful Target Target Info [1]
Rho-associated protein kinase 1 (ROCK1) Successful Target Target Info [2]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [3]
Bromodomain-containing protein 7 (BRD7) Literature-reported Target Target Info [4]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [5]
Protein(s) Regulated by This miRNA Twist-related protein 1 Regulated Protein [5]
References
REF 1 MiR-300 suppresses laryngeal squamous cell carcinoma proliferation and metastasis by targeting ROS1. Am J Transl Res. 2016 Sep 15;8(9):3903-3911.
REF 2 MicroRNA-300 inhibited glioblastoma progression through ROCK1. Oncotarget. 2016 Jun 14;7(24):36529-36538.
REF 3 MiR-300 regulate the malignancy of breast cancer by targeting p53. Int J Clin Exp Med. 2015 May 15;8(5):6957-66.
REF 4 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 5 MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.
REF 6 MicroRNAs in the imprinted DLK1-DIO3 region repress the epithelial-to-mesenchymal transition by targeting the TWIST1 protein signaling network. J Biol Chem. 2012 Dec 14;287(51):42695-707.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.