miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-301a-5p | ||||
| miRNA Stemloop AC | MI0000745 | ||||
| miRNA Stemloop ID | hsa-mir-301a | ||||
| Sequence | gcucugacuuuauugcacuacu | ||||
| TTD Target(s) Regulated by This miRNA | Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [1] | |
| B-cell translocation gene 1 protein (BTG1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Protein NDRG2 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Expression of MicroRNA-301a and its Functional Roles in Malignant Melanoma. Cell Physiol Biochem. 2016;40(1-2):230-244. | ||||
| REF 2 | MicroRNA 301A Promotes Intestinal Inflammation and Colitis-Associated Cancer Development by Inhibiting BTG1. Gastroenterology. 2017 May;152(6):1434-1448.e15. | ||||
| REF 3 | Hypoxia-Responsive Mir-301a and Mir-301b Promote Radioresistance of Prostate Cancer Cells via Downregulating NDRG2.Med Sci Monit. 2016 Jun 21;22:2126-32. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.