miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-301b-3p | ||||
| miRNA Stemloop AC | MI0005568 | ||||
| miRNA Stemloop ID | hsa-mir-301b | ||||
| Sequence | cagugcaaugauauugucaaagc | ||||
| TTD Target(s) Regulated by This miRNA | Mineralocorticoid receptor (MR) | Successful Target | Target Info | [1] | |
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [2] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [4] | ||
| Tumor protein 63 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | A Novel MIF Signaling Pathway Drives the Malignant Character of Pancreatic Cancer by Targeting NR3C2. Cancer Res. 2016 Jul 1;76(13):3838-50. | ||||
| REF 2 | MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 2010 Mar;51(3):881-90. | ||||
| REF 3 | The miR-130 family promotes cell migration and invasion in bladder cancer through FAK and Akt phosphorylation by regulating PTEN. Sci Rep. 2016 Feb 3;6:20574. | ||||
| REF 4 | Hypoxia-induced microRNA-301b regulates apoptosis by targeting Bim in lung cancer.Cell Prolif. 2016 Aug;49(4):476-83. | ||||
| REF 5 | MicroRNA-301b promotes cell invasiveness through targeting TP63 in pancreatic carcinoma cells.Int J Oncol. 2014 Mar;44(3):725-34. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.