miRNA General Information
miRNA Mature ID	hsa-miR-3064-5p
miRNA Stemloop AC	MI0017375
miRNA Stemloop ID	hsa-mir-3064
Sequence	ucuggcuguuguggugugcaa
TTD Target(s) Regulated by This miRNA	Telomerase reverse transcriptase (TERT)	Clinical trial Target	Target Info	[1]
References
REF 1	MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer. PLoS One. 2017 Mar 14;12(3):e0173912.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.