miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30b-3p | ||||
| miRNA Stemloop AC | MI0000441 | ||||
| miRNA Stemloop ID | hsa-mir-30b | ||||
| Sequence | cugggagguggauguuuacuuc | ||||
| TTD Target(s) Regulated by This miRNA | Nuclear receptor ROR-gamma (RORG) | Clinical trial Target | Target Info | [1] | |
| Beclin-1 (BECN1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Disintegrin and metalloproteinase domain-containing protein 12 | Regulated Protein | [3] | ||
| Transcriptional regulator ERG | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | T cell post-transcriptional miRNA-mRNA interaction networks identify targets associated with susceptibility/resistance to collagen-induced arthritis. PLoS One. 2013;8(1):e54803. | ||||
| REF 2 | MicroRNA-30b Regulates High Phosphorus Level-Induced Autophagy in Vascular Smooth Muscle Cells by Targeting BECN1. Cell Physiol Biochem. 2017;42(2):530-536. | ||||
| REF 3 | ADAM12-L is a direct target of the miR-29 and miR-200 families in breast cancer.BMC Cancer. 2015 Mar 4;15:93. | ||||
| REF 4 | Elevated expression of microRNA-30b in osteoarthritis and its role in ERG regulation of chondrocyte.Biomed Pharmacother. 2015 Dec;76:94-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.