miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30c-1-3p | ||||
| miRNA Stemloop AC | MI0000736 | ||||
| miRNA Stemloop ID | hsa-mir-30c-1 | ||||
| Sequence | cugggagaggguuguuuacucc | ||||
| TTD Target(s) Regulated by This miRNA | Pregnane X receptor (NR1I2) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Homeobox-containing protein 1 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MicroRNA-30c-1-3p is a silencer of the pregnane X receptor by targeting the 3'-untranslated region and alters the expression of its target gene cytochrome P450 3A4. Biochim Biophys Acta. 2016 Sep;1859(9):1238-1244. | ||||
| REF 2 | miR-30c-1* promotes natural killer cell cytotoxicity against human hepatoma cells by targeting the transcription factor HMBOX1.Cancer Sci. 2012 Apr;103(4):645-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.