miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30e-3p | ||||
| miRNA Stemloop AC | MI0000749 | ||||
| miRNA Stemloop ID | hsa-mir-30e | ||||
| Sequence | cuuucagucggauguuuacagc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | NF-kappa-B inhibitor alpha | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miRNA expression pattern associated with prognosis in elderly patients with advanced OPSC and OCC. Int J Oncol. 2013 Sep;43(3):839-49. | ||||
| REF 2 | MicroRNA-30e* promotes human glioma cell invasiveness in an orthotopic xenotransplantation model by disrupting the NF-B/IB negative feedback loop.J Clin Invest. 2012 Jan;122(1):33-47. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.