miRNA General Information
miRNA Mature ID hsa-miR-30e-5p
miRNA Stemloop AC MI0000749
miRNA Stemloop ID hsa-mir-30e
Sequence uguaaacauccuugacuggaag
TTD Target(s) Regulated by This miRNA Microsomal triglyceride transfer protein (MTTP) Successful Target Target Info [1]
Caspase-3 (CASP3) Clinical trial Target Target Info [2]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [3]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [3]
Prolyl 4-hydroxylasesubunit alpha-1 (P4HA1) Clinical trial Target Target Info [4]
Polycomb complex protein BMI-1 (BMI1) Literature-reported Target Target Info [5]
Muscleblind-like protein 1 (MBNL2) Literature-reported Target Target Info [6]
Protein(s) Regulated by This miRNA Autophagy protein 5 Regulated Protein [7]
Mucin-17 Regulated Protein [8]
Muscleblind-like protein 1 Regulated Protein [6]
Muscleblind-like protein 3 Regulated Protein [6]
Myb-related protein B Regulated Protein [10]
SUMO-conjugating enzyme UBC9 Regulated Protein [11]
Tumor suppressor candidate 3 Regulated Protein [12]
Zinc finger protein SNAI1 Regulated Protein [13]
References
REF 1 MiR-132, miR-15a and miR-16 synergistically inhibit pituitary tumor cell proliferation, invasion and migration by targeting Sox5. Cancer Lett. 2015 Jan 28;356(2 Pt B):568-78.
REF 2 miR-30e controls DNA damage-induced stress responses by modulating expression of the CDK inhibitor p21WAF1/CIP1 and caspase-3. Oncotarget. 2016 Mar 29;7(13):15915-29.
REF 3 Downregulation of microRNA-30 facilitates podocyte injury and is prevented by glucocorticoids. J Am Soc Nephrol. 2014 Jan;25(1):92-104.
REF 4 MiR-30e suppresses proliferation of hepatoma cells via targeting prolyl 4-hydroxylase subunit alpha-1 (P4HA1) mRNA. Biochem Biophys Res Commun. 2016 Apr 8;472(3):516-22.
REF 5 Identification of miR-30e* regulation of Bmi1 expression mediated by tumor-associated macrophages in gastrointestinal cancer. PLoS One. 2013 Nov 28;8(11):e81839.
REF 6 miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182.
REF 7 3,3'-Diindolylmethane induces anti-human gastric cancer cells by the miR-30e-ATG5 modulating autophagy.Biochem Pharmacol. 2016 Sep 1;115:77-84.
REF 8 DNA methylation and histone H3-K9 modifications contribute to MUC17 expression.Glycobiology. 2011 Feb;21(2):247-56.
REF 9 miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182.
REF 10 miR-29 and miR-30 regulate B-Myb expression during cellular senescence.Proc Natl Acad Sci U S A. 2011 Jan 11;108(2):522-7.
REF 11 MicroRNA-mediated regulation of Ubc9 expression in cancer cells.Clin Cancer Res. 2009 Mar 1;15(5):1550-7.
REF 12 SOX2 regulates multiple malignant processes of breast cancer development through the SOX2/miR-181a-5p, miR-30e-5p/TUSC3 axis.Mol Cancer. 2017 Mar 14;16(1):62.
REF 13 MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer.Int J Cancer. 2012 May 1;130(9):2044-53.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.