miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-30e-5p | ||||
| miRNA Stemloop AC | MI0000749 | ||||
| miRNA Stemloop ID | hsa-mir-30e | ||||
| Sequence | uguaaacauccuugacuggaag | ||||
| TTD Target(s) Regulated by This miRNA | Microsomal triglyceride transfer protein (MTTP) | Successful Target | Target Info | [1] | |
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [2] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [3] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [3] | ||
| Prolyl 4-hydroxylasesubunit alpha-1 (P4HA1) | Clinical trial Target | Target Info | [4] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [5] | ||
| Muscleblind-like protein 1 (MBNL2) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Autophagy protein 5 | Regulated Protein | [7] | ||
| Mucin-17 | Regulated Protein | [8] | |||
| Muscleblind-like protein 1 | Regulated Protein | [6] | |||
| Muscleblind-like protein 3 | Regulated Protein | [6] | |||
| Myb-related protein B | Regulated Protein | [10] | |||
| SUMO-conjugating enzyme UBC9 | Regulated Protein | [11] | |||
| Tumor suppressor candidate 3 | Regulated Protein | [12] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [13] | |||
| References | |||||
| REF 1 | MiR-132, miR-15a and miR-16 synergistically inhibit pituitary tumor cell proliferation, invasion and migration by targeting Sox5. Cancer Lett. 2015 Jan 28;356(2 Pt B):568-78. | ||||
| REF 2 | miR-30e controls DNA damage-induced stress responses by modulating expression of the CDK inhibitor p21WAF1/CIP1 and caspase-3. Oncotarget. 2016 Mar 29;7(13):15915-29. | ||||
| REF 3 | Downregulation of microRNA-30 facilitates podocyte injury and is prevented by glucocorticoids. J Am Soc Nephrol. 2014 Jan;25(1):92-104. | ||||
| REF 4 | MiR-30e suppresses proliferation of hepatoma cells via targeting prolyl 4-hydroxylase subunit alpha-1 (P4HA1) mRNA. Biochem Biophys Res Commun. 2016 Apr 8;472(3):516-22. | ||||
| REF 5 | Identification of miR-30e* regulation of Bmi1 expression mediated by tumor-associated macrophages in gastrointestinal cancer. PLoS One. 2013 Nov 28;8(11):e81839. | ||||
| REF 6 | miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182. | ||||
| REF 7 | 3,3'-Diindolylmethane induces anti-human gastric cancer cells by the miR-30e-ATG5 modulating autophagy.Biochem Pharmacol. 2016 Sep 1;115:77-84. | ||||
| REF 8 | DNA methylation and histone H3-K9 modifications contribute to MUC17 expression.Glycobiology. 2011 Feb;21(2):247-56. | ||||
| REF 9 | miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182. | ||||
| REF 10 | miR-29 and miR-30 regulate B-Myb expression during cellular senescence.Proc Natl Acad Sci U S A. 2011 Jan 11;108(2):522-7. | ||||
| REF 11 | MicroRNA-mediated regulation of Ubc9 expression in cancer cells.Clin Cancer Res. 2009 Mar 1;15(5):1550-7. | ||||
| REF 12 | SOX2 regulates multiple malignant processes of breast cancer development through the SOX2/miR-181a-5p, miR-30e-5p/TUSC3 axis.Mol Cancer. 2017 Mar 14;16(1):62. | ||||
| REF 13 | MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer.Int J Cancer. 2012 May 1;130(9):2044-53. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.