miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-3163 | ||||
| miRNA Stemloop AC | MI0014193 | ||||
| miRNA Stemloop ID | hsa-mir-3163 | ||||
| Sequence | uauaaaaugagggcaguaagac | ||||
| TTD Target(s) Regulated by This miRNA | DNA mismatch repair protein MSH2 (MSH2) | Literature-reported Target | Target Info | [1] | |
| S-phase kinase-associated protein 2 (SKP2) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | DNA mismatch repair protein Msh3 | Regulated Protein | [1] | ||
| References | |||||
| REF 1 | Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway. Mol Carcinog. 2017 Apr;56(4):1372-1379. | ||||
| REF 2 | Skp2 regulates non-small cell lung cancer cell growth by Meg3 and miR-3163. Tumour Biol. 2016 Mar;37(3):3925-31. | ||||
| REF 3 | Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway. Mol Carcinog. 2017 Apr;56(4):1372-1379. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.