miRNA General Information
miRNA Mature ID	hsa-miR-324-3p
miRNA Stemloop AC	MI0000813
miRNA Stemloop ID	hsa-mir-324
Sequence	cccacugccccaggugcugcugg
TTD Target(s) Regulated by This miRNA	Intercellular adhesion molecule ICAM-1 (ICAM1)	Successful Target	Target Info	[1]
	Transforming growth factor beta 1 (TGFB1)	Successful Target	Target Info	[1]
	Apoptosis regulator Bcl-xL (BCL-xL)	Clinical trial Target	Target Info	[2]
	CREB-binding protein (CREBBP)	Clinical trial Target	Target Info	[3]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[1]
Protein(s) Regulated by This miRNA	HLA class I histocompatibility antigen, alpha chain F	Regulated Protein	HLAF_HUMAN	[1]
	Protein Wnt-2b	Regulated Protein	WNT2B_HUMAN	[1]
	Protein Wnt-2b	Regulated Protein	WNT2B_HUMAN	[5]
	Protein Wnt-9b	Regulated Protein	WNT9B_HUMAN	[3]
	Segment polarity protein dishevelled homolog DVL-2	Regulated Protein	DVL2_HUMAN	[3]
References
REF 1	Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 2	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86.
REF 3	Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.
REF 4	Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 5	MicroRNA-324-3p regulates nasopharyngeal carcinoma radioresistance by directly targeting WNT2B.Eur J Cancer. 2013 Jul;49(11):2596-607.
REF 6	Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.