miRNA General Information
miRNA Mature ID	hsa-miR-337-3p
miRNA Stemloop AC	MI0000806
miRNA Stemloop ID	hsa-mir-337
Sequence	cuccuauaugaugccuuucuuc
TTD Target(s) Regulated by This miRNA	Signal transducer and activator of transcription 3 (STAT3)	Successful Target	Target Info	[1]
	Casein kinase II alpha (CSNK2A1)	Clinical trial Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Myeloid zinc finger 1	Regulated Protein	MZF1_HUMAN	[3]
	Ras-related protein Rap-1A	Regulated Protein	RAP1A_HUMAN	[1]
References
REF 1	miR-337-3p and its targets STAT3 and RAP1A modulate taxane sensitivity in non-small cell lung cancers. PLoS One. 2012;7(6):e39167.
REF 2	MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting subunit of protein kinase CKII in human colorectal cancer cells. Biochem Biophys Res Commun. 2012 Dec 14;429(3-4):173-9.
REF 3	miRNA-337-3p inhibits gastric cancer progression through repressing myeloid zinc finger 1-facilitated expression of matrix metalloproteinase 14.Oncotarget. 2016 Jun 28;7(26):40314-40328.
REF 4	miR-337-3p and its targets STAT3 and RAP1A modulate taxane sensitivity in non-small cell lung cancers. PLoS One. 2012;7(6):e39167.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.