miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-33a-3p | ||||
| miRNA Stemloop AC | MI0000091 | ||||
| miRNA Stemloop ID | hsa-mir-33a | ||||
| Sequence | caauguuuccacagugcaucac | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter A1 (ABCA1) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Pre-B-cell leukemia transcription factor 3 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects. Liver Int. 2016 Sep;36(9):1383-91. | ||||
| REF 2 | MicroRNA-33a-3p suppresses cell migration and invasion by directly targeting PBX3 in human hepatocellular carcinoma.Oncotarget. 2016 Jul 5;7(27):42461-42473. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.