miRNA General Information
miRNA Mature ID	hsa-miR-342-3p
miRNA Stemloop AC	MI0000805
miRNA Stemloop ID	hsa-mir-342
Sequence	ucucacacagaaaucgcacccgu
TTD Target(s) Regulated by This miRNA	DNA [cytosine-5]-methyltransferase 1 (DNMT1)	Clinical trial Target	Target Info	[1]
	E2F transcription factor 1 (E2F1)	Clinical trial Target	Target Info	[2]
	Metastasis adhesion protein (MTDH)	Literature-reported Target	Target Info	[3]
	Sterol regulatory element binding protein-1 (SREBF1)	Literature-reported Target	Target Info	[4]
	T-lymphoma invasion and metastasis 1 (TIAM1)	Literature-reported Target	Target Info	[5]
Protein(s) Regulated by This miRNA	Ankyrin repeat domain-containing protein 49	Regulated Protein	ANR49_HUMAN	[6]
	Baculoviral IAP repeat-containing protein 6	Regulated Protein	BIRC6_HUMAN	[7]
	Bone morphogenetic protein 7	Regulated Protein	BMP7_HUMAN	[8]
	C-terminal-binding protein 2	Regulated Protein	CTBP2_HUMAN	[9]
	Calcium/calmodulin-dependent protein kinase II inhibitor 1	Regulated Protein	CK2N1_HUMAN	[5]
	Cytoplasmic polyadenylation element-binding protein 4	Regulated Protein	CPEB4_HUMAN	[5]
	DNA-binding protein inhibitor ID-4	Regulated Protein	ID4_HUMAN	[11]
	E3 ubiquitin-protein transferase RMND5A	Regulated Protein	RMD5A_HUMAN	[5]
	Gem-associated protein 4	Regulated Protein	GEMI4_HUMAN	[8]
	Glucose-induced degradation protein 8 homolog	Regulated Protein	GID8_HUMAN	[5]
	NF-kappa-B essential modulator	Regulated Protein	NEMO_HUMAN	[12]
	Sterol regulatory element-binding protein 2	Regulated Protein	SRBP2_HUMAN	[4]
	Synaptopodin 2-like protein	Regulated Protein	SYP2L_HUMAN	[5]
	TGF-beta-activated kinase 1 and MAP3K7-binding protein 2	Regulated Protein	TAB2_HUMAN	[12]
	TGF-beta-activated kinase 1 and MAP3K7-binding protein 3	Regulated Protein	TAB3_HUMAN	[12]
References
REF 1	MicroRNA-342 inhibits colorectal cancer cell proliferation and invasion by directly targeting DNA methyltransferase 1. Carcinogenesis. 2011 Jul;32(7):1033-42.
REF 2	miR-342-3p regulates MYC transcriptional activity via direct repression of E2F1 in human lung cancer. Carcinogenesis. 2015 Dec;36(12):1464-73.
REF 3	Long noncoding RNA FTX is upregulated in gliomas and promotes proliferation and invasion of glioma cells by negatively regulating miR-342-3p. Lab Invest. 2017 Apr;97(4):447-457.
REF 4	MicroRNA-185 and 342 inhibit tumorigenicity and induce apoptosis through blockade of the SREBP metabolic pathway in prostate cancer cells. PLoS One. 2013 Aug 9;8(8):e70987.
REF 5	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 6	MicroRNA profiling in chemoresistant and chemosensitive acute myeloid leukemia.Cytogenet Genome Res. 2013;141(4):272-6.
REF 7	miR-342 overexpression results in a synthetic lethal phenotype in BRCA1-mutant HCC1937 breast cancer cells.Oncotarget. 2016 Apr 5;7(14):18594-604.
REF 8	Downregulation of miR-342 is associated with tamoxifen resistant breast tumors.Mol Cancer. 2010 Dec 20;9:317.
REF 9	Obesity-Associated MiR-342-3p Promotes Adipogenesis of Mesenchymal Stem Cells by Suppressing CtBP2 and Releasing C/EBP from CtBP2 Binding.Cell Physiol Biochem. 2015;35(6):2285-98.
REF 10	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 11	miR-342 regulates BRCA1 expression through modulation of ID4 in breast cancer.PLoS One. 2014 Jan 27;9(1):e87039.
REF 12	miR-342-3p affects hepatocellular carcinoma cell proliferation via regulating NF-B pathway.Biochem Biophys Res Commun. 2015 Feb 13;457(3):370-7.
REF 13	MicroRNA-185 and 342 inhibit tumorigenicity and induce apoptosis through blockade of the SREBP metabolic pathway in prostate cancer cells. PLoS One. 2013 Aug 9;8(8):e70987.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.