miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-342-5p | ||||
| miRNA Stemloop AC | MI0000805 | ||||
| miRNA Stemloop ID | hsa-mir-342 | ||||
| Sequence | aggggugcuaucugugauuga | ||||
| TTD Target(s) Regulated by This miRNA | DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [1] | |
| Endoglin CD105 (ENG) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | N-alpha-acetyltransferase 10 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MicroRNA-dependent regulation of DNA methyltransferase-1 and tumor suppressor gene expression by interleukin-6 in human malignant cholangiocytes. Hepatology. 2010 Mar;51(3):881-90. | ||||
| REF 2 | miR-342-5p Is a Notch Downstream Molecule and Regulates Multiple Angiogenic Pathways Including Notch, Vascular Endothelial Growth Factor and Transforming Growth Factor Signaling. J Am Heart Assoc. 2016 Feb 8;5(2). pii: e003042. | ||||
| REF 3 | microRNA-342-5p and miR-608 inhibit colon cancer tumorigenesis by targeting NAA10.Oncotarget. 2016 Jan 19;7(3):2709-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.