miRNA General Information
miRNA Mature ID	hsa-miR-34c-3p
miRNA Stemloop AC	MI0000743
miRNA Stemloop ID	hsa-mir-34c
Sequence	aaucacuaaccacacggccagg
TTD Target(s) Regulated by This miRNA	Beta-catenin (CTNNB1)	Successful Target	Target Info	[1]
	Myristoylated alanine-rich C-kinase substrate (MARCKS)	Clinical trial Target	Target Info	[2]
	Eukaryotic initiation factor 4E (EIF4E)	Literature-reported Target	Target Info	[3]
Protein(s) Regulated by This miRNA	Axin-2	Regulated Protein	AXIN2_HUMAN	[1]
	Lymphoid enhancer-binding factor 1	Regulated Protein	LEF1_HUMAN	[1]
	Nck-associated protein 1	Regulated Protein	NCKP1_HUMAN	[5]
	PI-PLC X domain-containing protein 3	Regulated Protein	PLCX3_HUMAN	[6]
	Proteasome assembly chaperone 1	Regulated Protein	PSMG1_HUMAN	[7]
References
REF 1	MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81.
REF 2	miR-34c-3p inhibits cell proliferation, migration and invasion of hepatocellular carcinoma by targeting MARCKS. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12728-37.
REF 3	miR-34c-3p functions as a tumour suppressor by inhibiting eIF4E expression in non-small cell lung cancer. Cell Prolif. 2015 Oct;48(5):582-92.
REF 4	MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81.
REF 5	MicroRNA-34c-3p promotes cell proliferation and invasion in hepatocellular carcinoma by regulation of NCKAP1 expression.J Cancer Res Clin Oncol. 2017 Feb;143(2):263-273.
REF 6	Integrated analysis miRNA and mRNA profiling in patients with severe oligozoospermia reveals miR-34c-3p downregulates PLCXD3 expression.Oncotarget. 2016 Aug 16;7(33):52781-52796.
REF 7	MiR-34c-3p suppresses the proliferation and invasion of non-small cell lung cancer (NSCLC) by inhibiting PAC1/MAPK pathway. Int J Clin Exp Pathol. 2015 Jun 1;8(6):6312-22.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.