miRNA General Information
miRNA Mature ID	hsa-miR-361-5p
miRNA Stemloop AC	MI0000760
miRNA Stemloop ID	hsa-mir-361
Sequence	uuaucagaaucuccagggguac
TTD Target(s) Regulated by This miRNA	Vascular endothelial growth factor A (VEGFA)	Successful Target	Target Info	[1]
	C-X-C chemokine receptor type 6 (CXCR6)	Literature-reported Target	Target Info	[2]
	Signal transducer and activator of transcription 6 (STAT6)	Literature-reported Target	Target Info	[3]
Protein(s) Regulated by This miRNA	Staphylococcal nuclease domain-containing protein 1	Regulated Protein	SND1_HUMAN	[4]
	Twist-related protein 1	Regulated Protein	TWST1_HUMAN	[5]
References
REF 1	Antiangiogenic role of miR-361 in human umbilical vein endothelial cells: functional interaction with the peptide somatostatin. Naunyn Schmiedebergs Arch Pharmacol. 2013 Jan;386(1):15-27.
REF 2	MicroRNA-361-5p Inhibits Cancer Cell Growth by Targeting CXCR6 in Hepatocellular Carcinoma. Cell Physiol Biochem. 2016;38(2):777-85.
REF 3	MiR-361-5p acts as a tumor suppressor in prostate cancer by targeting signal transducer and activator of transcription-6(STAT6). Biochem Biophys Res Commun. 2014 Feb 28;445(1):151-6.
REF 4	MiR-361-5p inhibits colorectal and gastric cancer growth and metastasis by targeting staphylococcal nuclease domain containing-1.Oncotarget. 2015 Jul 10;6(19):17404-16.
REF 5	MicroRNA-361-5p inhibits epithelial-to-mesenchymal transition of glioma cells through targeting Twist1.Oncol Rep. 2017 Mar;37(3):1849-1856.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.