miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-365a-3p | ||||
| miRNA Stemloop AC | MI0000767 | ||||
| miRNA Stemloop ID | hsa-mir-365a | ||||
| Sequence | uaaugccccuaaaaauccuuau | ||||
| miRNA General Information | |||||
| miRNA Mature ID | hsa-miR-365a-3p | ||||
| miRNA Stemloop AC | MI0000767 | MI0000769 | ||||
| miRNA Stemloop ID | hsa-mir-365-1 | hsa-mir-365-2 | ||||
| Sequence | uaaugccccuaaaaauccuuau | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Interleukin-6 (IL6) | Successful Target | Target Info | [2] | ||
| Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [3] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [4] | ||
| Activin receptor-like kinase 2 (ALK-2) | Clinical trial Target | Target Info | [5] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Apoptosis regulator BAX | Regulated Protein | [6] | ||
| Paired box protein Pax-6 | Regulated Protein | [7] | |||
| Protein max | Regulated Protein | [8] | |||
| Rho-related GTP-binding protein RhoH | Regulated Protein | [9] | |||
| SHC-transforming protein 1 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | microRNA-365, down-regulated in colon cancer, inhibits cell cycle progression and promotes apoptosis of colon cancer cells by probably targeting Cyclin D1 and Bcl-2. Carcinogenesis. 2012 Jan;33(1):220-5. | ||||
| REF 2 | miR-365, a novel negative regulator of interleukin-6 gene expression, is cooperatively regulated by Sp1 and NF-kappaB. J Biol Chem. 2011 Jun 17;286(24):21401-12. | ||||
| REF 3 | Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405. | ||||
| REF 4 | Akt-p53-miR-365-cyclin D1/cdc25A axis contributes to gastric tumorigenesis induced by PTEN deficiency. Nat Commun. 2013;4:2544. | ||||
| REF 5 | The role of the 3'UTR region in the regulation of the ACVR1/Alk-2 gene expression. PLoS One. 2012;7(12):e50958. | ||||
| REF 6 | MiR-365 induces gemcitabine resistance in pancreatic cancer cells by targeting the adaptor protein SHC1 and pro-apoptotic regulator BAX.Cell Signal. 2014 Feb;26(2):179-85. | ||||
| REF 7 | MiR-365b-3p, down-regulated in retinoblastoma, regulates cell cycle progression and apoptosis of human retinoblastoma cells by targeting PAX6.FEBS Lett. 2013 Jun 19;587(12):1779-86. | ||||
| REF 8 | miR-193b/365a cluster controls progression of epidermal squamous cell carcinoma.Carcinogenesis. 2014 May;35(5):1110-20. | ||||
| REF 9 | Serum microRNA-365 in combination with its target gene TTF-1 as a non-invasive prognostic marker for non-small cell lung cancer.Biomed Pharmacother. 2015 Oct;75:185-90. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.