miRNA General Information
miRNA Mature ID	hsa-miR-369-5p
miRNA Stemloop AC	MI0000777
miRNA Stemloop ID	hsa-mir-369
Sequence	agaucgaccguguuauauucgc
TTD Target(s) Regulated by This miRNA	DNA [cytosine-5]-methyltransferase 3B (DNMT3B)	Clinical trial Target	Target Info	[1]
	DNA [cytosine-5]-methyltransferase 3A (DNMT3A)	Patented-recorded Target	Target Info	[1]
	Fatty acid-binding protein 4 (FABP4)	Patented-recorded Target	Target Info	[1]
References
REF 1	Adipogenic differentiation of human mesenchymal stromal cells is down-regulated by microRNA-369-5p and up-regulated by microRNA-371. J Cell Physiol. 2011 Sep;226(9):2226-34.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.