miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-370-3p | ||||
| miRNA Stemloop AC | MI0000778 | ||||
| miRNA Stemloop ID | hsa-mir-370 | ||||
| Sequence | gccugcugggguggaaccuggu | ||||
| TTD Target(s) Regulated by This miRNA | Beta-catenin (CTNNB1) | Successful Target | Target Info | [1] | |
| O-6-methylguanine-DNA-alkyltransferase (MGMT) | Clinical trial Target | Target Info | [2] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [3] | ||
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [4] | ||
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [5] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Carnitine O-palmitoyltransferase 1, liver isoform | Regulated Protein | [7] | ||
| Growth arrest and DNA damage-inducible protein GADD45 alpha | Regulated Protein | [8] | |||
| Neurofibromin | Regulated Protein | [9] | |||
| Protein lin-28 homolog A | Regulated Protein | [10] | |||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | MicroRNA-370-3p inhibits human glioma cell proliferation and induces cell cycle arrest by directly targeting -catenin. Brain Res. 2016 Aug 1;1644:53-61. | ||||
| REF 2 | Up-regulation of miR-370-3p restores glioblastoma multiforme sensitivity to temozolomide by influencing MGMT expression. Sci Rep. 2016 Sep 6;6:32972. | ||||
| REF 3 | Overexpression of miR-370 and downregulation of its novel target TGF-RII contribute to the progression of gastric carcinoma. Oncogene. 2012 Jan 12;31(2):226-37. | ||||
| REF 4 | The tumor suppressive role of miRNA-370 by targeting FoxM1 in acute myeloid leukemia. Mol Cancer. 2012 Aug 17;11:56. | ||||
| REF 5 | Upregulation of MircoRNA-370 induces proliferation in human prostate cancer cells by downregulating the transcription factor FOXO1. PLoS One. 2012;7(9):e45825. | ||||
| REF 6 | HMGA2 maintains oncogenic RAS-induced epithelial-mesenchymal transition in human pancreatic cancer cells. Am J Pathol. 2009 Mar;174(3):854-68. | ||||
| REF 7 | MicroRNA-370 controls the expression of microRNA-122 and Cpt1alpha and affects lipid metabolism.J Lipid Res. 2010 Jun;51(6):1513-23. | ||||
| REF 8 | miR-146a and miR-370 coordinate enterovirus 71-induced cell apoptosis through targeting SOS1 and GADD45.Cell Microbiol. 2015 Jun;17(6):802-18. | ||||
| REF 9 | Integration of SNP and mRNA arrays with microRNA profiling reveals that MiR-370 is upregulated and targets NF1 in acute myeloid leukemia.PLoS One. 2012;7(10):e47717. | ||||
| REF 10 | Inducible interleukin 32 (IL-32) exerts extensive antiviral function via selective stimulation of interferon 1 (IFN-1).J Biol Chem. 2013 Jul 19;288(29):20927-41. | ||||
| REF 11 | Up-regulation of p21(WAF1/CIP1) by miRNAs and its implications in bladder cancer cells.FEBS Lett. 2014 Dec 20;588(24):4654-64. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.