miRNA General Information
miRNA Mature ID	hsa-miR-370-5p
miRNA Stemloop AC	MI0000778
miRNA Stemloop ID	hsa-mir-370
Sequence	caggucacgucucugcaguuac
TTD Target(s) Regulated by This miRNA	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[1]
References
REF 1	Upregulation of microRNA-370 promotes cell apoptosis and inhibits proliferation by targeting PTEN in human gastric cancer. Int J Oncol. 2016 Oct;49(4):1589-99.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.