miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-371a-3p | ||||
| miRNA Stemloop AC | MI0000779 | ||||
| miRNA Stemloop ID | hsa-mir-371a | ||||
| Sequence | aagugccgccaucuuuugagugu | ||||
| TTD Target(s) Regulated by This miRNA | Dickkopf-related protein 1 (DKK1) | Clinical trial Target | Target Info | [1] | |
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-4 | Regulated Protein | [3] | ||
| Peroxiredoxin-6 | Regulated Protein | [3] | |||
| Syntaxin-12 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78. | ||||
| REF 2 | Stem cell-like micro-RNA signature driven by Myc in aggressive liver cancer. Proc Natl Acad Sci U S A. 2010 Nov 23;107(47):20471-6. | ||||
| REF 3 | Functional screening implicates miR-371-3p and peroxiredoxin 6 in reversible tolerance to cancer drugs.Nat Commun. 2016 Aug 3;7:12351. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.