miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-371a-5p | ||||
| miRNA Stemloop AC | MI0000779 | ||||
| miRNA Stemloop ID | hsa-mir-371a | ||||
| Sequence | acucaaacugugggggcacu | ||||
| TTD Target(s) Regulated by This miRNA | Heat shock protein 90 alpha (HSP90A) | Successful Target | Target Info | [1] | |
| Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [1] | ||
| Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Serine/threonine-protein kinase PRP4 homolog | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486. | ||||
| REF 2 | MicroRNA-371-5p targets SOX2 in gastric cancer. Oncotarget. 2016 May 31;7(22):31993-2005. | ||||
| REF 3 | miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells.Cancer Lett. 2013 Jul 28;335(2):351-60. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.