miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-375-3p | ||||
| miRNA Stemloop AC | MI0000783 | ||||
| miRNA Stemloop ID | hsa-mir-375 | ||||
| Sequence | uuuguucguucggcucgcguga | ||||
| TTD Target(s) Regulated by This miRNA | Janus kinase 2 (JAK-2) | Successful Target | Target Info | [1] | |
| Yes-associated protein 1 (YAP1) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Regulation of JAK2 by miR-135a: prognostic impact in classic Hodgkin lymphoma. Blood. 2009 Oct 1;114(14):2945-51. | ||||
| REF 2 | Experience of a rapid access blackout service for older people. Age Ageing. 2010 Mar;39(2):265-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.