miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-376b-3p | ||||
| miRNA Stemloop AC | MI0002466 | ||||
| miRNA Stemloop ID | hsa-mir-376b | ||||
| Sequence | aucauagaggaaaauccauguu | ||||
| TTD Target(s) Regulated by This miRNA | Beclin-1 (BECN1) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Activin receptor type-1C | Regulated Protein | [2] | ||
| Cysteine protease ATG4C | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | miR-376b controls starvation and mTOR inhibition-related autophagy by targeting ATG4C and BECN1. Autophagy. 2012 Feb 1;8(2):165-76. | ||||
| REF 2 | MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68. | ||||
| REF 3 | miR-376b controls starvation and mTOR inhibition-related autophagy by targeting ATG4C and BECN1. Autophagy. 2012 Feb 1;8(2):165-76. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.