miRNA General Information
miRNA Mature ID	hsa-miR-382-3p
miRNA Stemloop AC	MI0000790
miRNA Stemloop ID	hsa-mir-382
Sequence	aaucauucacggacaacacuu
TTD Target(s) Regulated by This miRNA	RAC-alpha serine/threonine-protein kinase (AKT1)	Successful Target	Target Info	[1]
References
REF 1	miR-382 targeting PTEN-Akt axis promotes liver regeneration. Oncotarget. 2016 Jan 12;7(2):1584-97.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.