miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-422a | ||||
| miRNA Stemloop AC | MI0001444 | ||||
| miRNA Stemloop ID | hsa-mir-422a | ||||
| Sequence | acuggacuuagggucagaaggc | ||||
| TTD Target(s) Regulated by This miRNA | PI3-kinase alpha (PIK3CA) | Successful Target | Target Info | [1] | |
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [2] | ||
| Telomerase reverse transcriptase (TERT) | Clinical trial Target | Target Info | [3] | ||
| Ecto-5'-nucleotidase (CD73) | Clinical trial Target | Target Info | [4] | ||
| Forkhead box protein Q1 (FOXQ1) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | 7-alpha-hydroxycholest-4-en-3-one 12-alpha-hydroxylase | Regulated Protein | [6] | ||
| Cholesterol 7-alpha-monooxygenase | Regulated Protein | [6] | |||
| Forkhead box protein E1 | Regulated Protein | [5] | |||
| Forkhead box protein G1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | MiR-422a acts as a tumor suppressor in glioblastoma by targeting PIK3CA. Am J Cancer Res. 2016 Aug 1;6(8):1695-707. | ||||
| REF 2 | Overexpression of miR-422a inhibits cell proliferation and invasion, and enhances chemosensitivity in osteosarcoma cells. Oncol Rep. 2016 Dec;36(6):3371-3378. | ||||
| REF 3 | Screening and preliminary validation of miRNAs with the regulation of hTERT in colorectal cancer. Oncol Rep. 2015 Jun;33(6):2728-36. | ||||
| REF 4 | MiR-422a promotes loco-regional recurrence by targeting NT5E/CD73 in head and neck squamous cell carcinoma. Oncotarget. 2016 Jul 12;7(28):44023-44038. | ||||
| REF 5 | Double-negative feedback loop between microRNA-422a and forkhead box (FOX)G1/Q1/E1 regulates hepatocellular carcinoma tumor growth and metastasis. Hepatology. 2015 Feb;61(2):561-73. | ||||
| REF 6 | A putative role of micro RNA in regulation of cholesterol 7alpha-hydroxylase expression in human hepatocytes.J Lipid Res. 2010 Aug;51(8):2223-33. | ||||
| REF 7 | Double-negative feedback loop between microRNA-422a and forkhead box (FOX)G1/Q1/E1 regulates hepatocellular carcinoma tumor growth and metastasis. Hepatology. 2015 Feb;61(2):561-73. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.