miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-423-5p | ||||
| miRNA Stemloop AC | MI0001445 | ||||
| miRNA Stemloop ID | hsa-mir-423 | ||||
| Sequence | ugaggggcagagagcgagacuuu | ||||
| TTD Target(s) Regulated by This miRNA | Trefoil factor-1 (TFF1) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Protein FAM3A | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miRNA423-5p regulates cell proliferation and invasion by targeting trefoil factor 1 in gastric cancer cells. Cancer Lett. 2014 May 28;347(1):98-104. | ||||
| REF 2 | NFE2 Induces miR-423-5p to Promote Gluconeogenesis and Hyperglycemia by Repressing the Hepatic FAM3A-ATP-Akt Pathway.Diabetes. 2017 Jul;66(7):1819-1832. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.