miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-424-3p | ||||
| miRNA Stemloop AC | MI0001446 | ||||
| miRNA Stemloop ID | hsa-mir-424 | ||||
| Sequence | caaaacgugaggcgcugcuau | ||||
| TTD Target(s) Regulated by This miRNA | Galectin-3 (LGALS3) | Clinical trial Target | Target Info | [1] | |
| Yes-associated protein 1 (YAP1) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | The MUC1 and galectin-3 oncoproteins function in a microRNA-dependent regulatory loop. Mol Cell. 2007 Sep 21;27(6):992-1004. | ||||
| REF 2 | Loss of MiR-424-3p, not miR-424-5p, confers chemoresistance through targeting YAP1 in non-small cell lung cancer. Mol Carcinog. 2017 Mar;56(3):821-832. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.