miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-432-5p | ||||
| miRNA Stemloop AC | MI0003133 | ||||
| miRNA Stemloop ID | hsa-mir-432 | ||||
| Sequence | ucuuggaguaggucauugggugg | ||||
| TTD Target(s) Regulated by This miRNA | Methyl cpg binding protein 2 (MECP2) | Clinical trial Target | Target Info | [1] | |
| Nestin (NES) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Double-stranded RNA-specific adenosine deaminase | Regulated Protein | [2] | ||
| REST corepressor 1 | Regulated Protein | [1] | |||
| References | |||||
| REF 1 | MicroRNA-432 contributes to dopamine cocktail and retinoic acid induced differentiation of human neuroblastoma cells by targeting NESTIN and RCOR1 genes. FEBS Lett. 2014 May 2;588(9):1706-14. | ||||
| REF 2 | MicroRNA-mediated loss of ADAR1 in metastatic melanoma promotes tumor growth.J Clin Invest. 2013 Jun;123(6):2703-18. | ||||
| REF 3 | MicroRNA-432 contributes to dopamine cocktail and retinoic acid induced differentiation of human neuroblastoma cells by targeting NESTIN and RCOR1 genes. FEBS Lett. 2014 May 2;588(9):1706-14. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.