miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-433-5p | ||||
| miRNA Stemloop AC | MI0001723 | ||||
| miRNA Stemloop ID | hsa-mir-433 | ||||
| Sequence | uacggugagccugucauuauuc | ||||
| TTD Target(s) Regulated by This miRNA | Osteonectin (SPARC) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Glutamate--cysteine ligase catalytic subunit | Regulated Protein | [2] | ||
| Glutamate--cysteine ligase regulatory subunit | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | A single nucleotide polymorphism in osteonectin 3' untranslated region regulates bone volume and is targeted by miR-433. J Bone Miner Res. 2015 Apr;30(4):723-32. | ||||
| REF 2 | Targeting of Gamma-Glutamyl-Cysteine Ligase by miR-433 Reduces Glutathione Biosynthesis and Promotes TGF--Dependent Fibrogenesis.Antioxid Redox Signal. 2015 Nov 10;23(14):1092-105. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.