miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-4496 | ||||
miRNA Stemloop AC | MI0016858 | ||||
miRNA Stemloop ID | hsa-mir-4496 | ||||
Sequence | gaggaaacugaagcugagaggg | ||||
TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [1] | |
References | |||||
REF 1 | MicroRNA-320a and microRNA-4496 attenuate Helicobacter pylori cytotoxin-associated gene A (CagA)-induced cancer-initiating potential and chemoresistance by targeting -catenin and ATP-binding cassette, subfamily G, member 2. J Pathol. 2017 Apr;241(5):614-625. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.