miRNA General Information
miRNA Mature ID	hsa-miR-4649-3p
miRNA Stemloop AC	MI0017276
miRNA Stemloop ID	hsa-mir-4649
Sequence	ucugaggccugccucucccca
TTD Target(s) Regulated by This miRNA	Protein-tyrosine phosphatase SHP-1 (PTPN6)	Patented-recorded Target	Target Info	[1]
References
REF 1	MicroRNA-4649-3p inhibits cell proliferation by targeting protein tyrosine phosphatase SHP-1 in nasopharyngeal carcinoma cells. Int J Mol Med. 2015 Aug;36(2):559-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.