miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-485-3p | ||||
| miRNA Stemloop AC | MI0002469 | ||||
| miRNA Stemloop ID | hsa-mir-485 | ||||
| Sequence | gucauacacggcucuccucucu | ||||
| TTD Target(s) Regulated by This miRNA | NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [1] | |
| Solute carrier family 40 member 1 (SLC40A1) | Clinical trial Target | Target Info | [2] | ||
| Polybromo-1 (PBRM1) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Nuclear transcription factor Y subunit beta | Regulated Protein | [4] | ||
| Peroxisome proliferator-activated receptor gamma coactivator 1-alpha | Regulated Protein | [5] | |||
| S-adenosylmethionine synthase isoform type-1 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. | ||||
| REF 2 | Iron-responsive miR-485-3p regulates cellular iron homeostasis by targeting ferroportin. PLoS Genet. 2013 Apr;9(4):e1003408. | ||||
| REF 3 | The microRNA miR-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral replication. Sci Signal. 2015 Dec 8;8(406):ra126. | ||||
| REF 4 | Novel regulation of nuclear factor-YB by miR-485-3p affects the expression of DNA topoisomerase II and drug responsiveness.Mol Pharmacol. 2011 Apr;79(4):735-41. | ||||
| REF 5 | MiR-485-3p and miR-485-5p suppress breast cancer cell metastasis by inhibiting PGC-1 expression.Cell Death Dis. 2016 Mar 24;7:e2159. | ||||
| REF 6 | MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma.J Clin Invest. 2013 Jan;123(1):285-98. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.